B6

acta2-optoα1AR-IRES-lacZ Strain Information Sheet

request mice

Strain Name:

Common Name: acta2-optoα1AR-IRES-lacZ

CHROMusTM designation and lines available: R24:B6 Line 1

Jackson Stock number: NA

Development: The rhodopsin based effector, optoα1AR which on activation generates the second messenger diacylglycerol/IP3, was inserted at the ATG site of the acta2 gene in the BAC RP23-370F21 (CHORI) through homologous recombination. The resulting recombinant BAC was injected into the male pronucleus of fertilized oocytes which were then implanted into pseudo pregnant females. Resulting offspring were screened for the presence of the transgene (founders). Colonies were established from each founder and tested for expression.

Transgenic Numbers:

# pups born # founders # expressers
3 1 1

Description: The rhodopsin based effector, optoα1AR is expressed under control of the acta2 promoter, directing expression to smooth muscle cells in blood vessels, airways of the lung and gut. Expression may be present in other smooth muscle containing tissues which have not been examined. An internal ribosome entry site (IRES) allows for co-expression of lacZ as a visual indicator of expression patterns.

Phenotypic Data:

acta2-optoa1AR-IRES-lacZ (l-r) vessels in the diaphragm and brain, smooth muscle lined bronchioles in the lung, small intestine showing lacZ staining

acta2-optoa1AR-IRES-lacZ (l-r) vessels in the diaphragm and brain, smooth muscle lined bronchioles in the lung, small intestine showing lacZ staining

acta2-optoa1AR-IRES-lacZ smooth muscle showing contraction of arterioles following photo stimulation

acta2-optoa1AR-IRES-lacZ smooth muscle showing contraction of arterioles following photo stimulation

Genotyping Protocol:

Primer B101 GGGTTGGTCCCGCTATATTC
Primer B102 GAAGGCAGGGATGGTCATAAA
Expected size of product: 478bp

Cycling conditions:

94oC 3 minutes
Repeat 30 times
30 sec @ 94oC
30 sec @ 58oC
30 sec @ 72oC
72oC 5 minutes
10oC hold

 PCR results for optoa1AR B101 x B102

Terms of Use: Please contact chromus@cornell.edu for information on MTA and fees.

So as to appropriately acknowledge and credit the scientists who have produced the acta2-optoα1AR-IRES-lacZ mouse strain, it is expected that you will include these individuals in any publication that is submitted prior to the initial publication of this line from the Kotlikoff laboratory.

Acknowledgement: Please inform us of any publications resulting from the use of this mouse and use the following statement to acknowledge their development:

The mouse strain acta2-optoα1AR-IRES-lacZ was developed by CHROMusTM which is supported by the National Heart Lung Blood Institute of the National Institute of Health under award number R24HL120847.

Comments are closed