acta2-CatCh-IRES-lacZ Strain Information Sheet
Strain Name:
Common Name: acta2-CatCh-IRES-lacZ
CHROMusTM designation and lines available: R24:B8 Line 3
Jackson Stock number: Jax# 028348
Development: The rhodopsin based effector, CatCh was inserted at the ATG site of the acta2 gene in the BAC RP23-370F21 (CHORI) through homologous recombination. The resulting recombinant BAC was injected into the male pronucleus of fertilized oocytes which were then implanted into pseudo pregnant females. Resulting offspring were screened for the presence of the transgene (founders). Colonies were established from each founder and tested for expression.
Transgenic Numbers:
| # pups born | # founders | # expressers |
| 11 | 3 | 2 |
Description: The rhodopsin based effector, CatCh is expressed under control of the acta2 promoter, directing expression to smooth muscle cells in blood vessels, airways of the lung and gut. Expression may be present in other smooth muscle containing tissues which have not been examined. An internal ribosome entry site (IRES) allows for co-expression of lacZ as a visual indicator of expression patterns.
Phenotypic Data:
qPCR analysis of CatCh message in the bladder
Acta2-CatCh-IRES-lacZ, line 3: lacZ staining of smooth muscle in whole or frozen tissue, including vessels in the brain and heart, vessels and bronchioles in the lung, smooth muscle layer in the bladder.
Photo-activation of CatCh. Blue light is flashed at t=6 seconds, inducing vasoconstriction in vascular smooth muscle. See screenshots below.
Vasoconstriction of vascular smooth muscle following photo-activation of CatCh.
photo activation induces vasoconstriction
Light induced ChR2 currents in arterial myocytes.
Genotyping Protocol:
| Primer B107 | GGAGATCTATGTGTGCGCTATC |
| Primer B108 | CCAGCAGTTCTTCGACATCA |
| Expected size of product: | 535bp |
Cycling conditions:
|
PCR results:
|
Terms of Use: Please contact chromus@cornell.edu for information on MTA and fees.
So as to appropriately acknowledge and credit the scientists who have produced the acta2-CatCh-IRES-lacZ mouse strain, it is expected that you will include these individuals in any publication that is submitted prior to the initial publication of this line from the Kotlikoff laboratory.
Acknowledgement: Please inform us of any publications resulting from the use of this mouse and use the following statement to acknowledge their development:
The mouse strain acta2-CatCh-IRES-lacZ was developed by CHROMusTM which is supported by the National Heart Lung Blood Institute of the National Institute of Health under award number R24HL120847.