B36

B36: Aldh1L1-optoα1AR-IRES-lacZ Strain Information Sheet

indicate interest

Strain Name:

Common Name: Aldh1L1-optoα1AR-IRES-lacZ

CHROMusTM designation and lines available: R24:B36

Jackson Stock number: JAX# 033706

Development: The rhodopsin based effector, optoα1AR which on activation generates the second messenger diacylglycerol/IP3, was inserted at the ATG site of the Aldh1L1 gene in the BAC RP23-7M9 (CHORI) through homologous recombination. The resulting recombinant BAC was injected into the male pronucleus of fertilized oocytes which were then implanted into pseudo pregnant females. Resulting offspring were screened for the presence of the transgene (founders). Colonies were established from each founder and tested for expression.

Transgenic Numbers:

# pups born # founders # expressors
50 9 2

Description: The rhodopsin based effector, optoα1AR is expressed under control of the Aldh1L1 promoter, directing expression to astrocytes.  Expression is observed in the brain. An internal ribosome entry site (IRES) allows for co-expression of lacZ as a visual indicator of expression patterns. This mouse is useful for activating second messengers in neuronal cells.  NOTE: functional analysis of this mouse line is ongoing.

Phenotypic Data:

Functional analysis is ongoing. LacZ staining of the brain shows appropriate expression patterns.

Genotyping Protocol:

Primer B101 GGGTTGGTCCCGCTATATTC
Primer B102 GAAGGCAGGGATGGTCATAAA
Expected size of product: 478bp
Cycling conditions:

  1. 94oC 3 minutes
  2. Repeat 30 times
    1. 30 sec @ 94oC
    2. 30 sec @ 58oC
    3. 30 sec @ 72oC
  3. 72oC 5 minutes
  4. 10oC hold

PCR results:

PCR results for optoa1AR B101 x B102

Terms of Use: Please contact chromus@cornell.edu for information on MTA and fees.

So as to appropriately acknowledge and credit the scientists who have produced the Aldh1L1-optoα1AR-IRES-lacZ mouse strain, it is expected that you will include these individuals in any publication that is submitted prior to the initial publication of this line from the Kotlikoff laboratory.

Acknowledgement: Please inform us of any publications resulting from the use of this mouse and use the following statement to acknowledge their development:

The mouse strain Aldh1L1-optoα1AR-IRES-lacZ was developed by CHROMusTM which is supported by the National Heart Lung Blood Institute of the National Institute of Health under award number R24HL120847.

Comments are closed