B38: Ly6G-optoβ2AR-IRES-mVermilion Strain Information Sheet
Strain Name:
Common Name: Ly6G-optoβ2AR-IRES-mVermilion
CHROMusTM designation and lines available: R24:B38
Jackson Stock number: NA
Development: The rhodopsin based effector, optoβ2AR which on activation generates the second messenger cyclic AMP was inserted at the ATG site of the Ly6G gene in the BAC RP24-268F10 (CHORI) through homologous recombination. The resulting recombinant BAC was injected into the male pronucleus of fertilized oocytes which were then implanted into pseudo pregnant females. Resulting offspring were screened for the presence of the transgene (founders). Colonies were established from each founder and tested for expression.
Transgenic Numbers:
# pups born | # founders | # expressors |
53 | 21 | 1 |
Description: The rhodopsin based effector, optoβ2AR is expressed under control of the Ly6G promoter, directing expression to neutrophils. An internal ribosome entry site (IRES) allows for co-expression of the red fluorescent protein mVermilion as a visual indicator of expression patterns. This mouse is useful for activating second messengers in neutrophils.
Phenotypic Data:
NOTE: Functional analysis is ongoing. Quantitative PCR analysis indicates Line 16 expresses the mRNA for optoβ2AR.
Genotyping Protocol:
Primer B166 | GTCCACTTCTGAAAGACCTTGT |
Primer B72 | TTCAACACGGTTTGGAGGCG |
Expected size of product: | 600 bp |
Cycling conditions:
|
|
Terms of Use: Please contact chromus@cornell.edu for information on MTA and fees.
So as to appropriately acknowledge and credit the scientists who have produced the Ly6G-optoβ2AR-IRES-lacZ mouse strain, it is expected that you will include these individuals in any publication that is submitted prior to the initial publication of this line from the Kotlikoff laboratory.
Acknowledgement: Please inform us of any publications resulting from the use of this mouse and use the following statement to acknowledge their development:
The mouse strain Ly6G-optoβ2AR-IRES-lacZ was developed by CHROMusTM which is supported by the National Heart Lung Blood Institute of the National Institute of Health under award number R24HL120847.