FoxJ1-GCaMP8.1 Strain Information Sheet
Strain Name:
Common Name: FoxJ1-GCaMP8.1
CHROMusTM designation and lines available: R24:B35
Jackson Stock number: Jax# 032888
Development: The green fluorescent calcium indicator GCaMP8.1 was inserted at the ATG site of the cdh5 gene in the BAC RP23-166G11 (CHORI) through homologous recombination. The resulting recombinant BAC was injected into the male pronucleus of fertilized oocytes which were then implanted into pseudo pregnant females. Resulting offspring were screened for the presence of the transgene (founders). Colonies were established from each founder and tested for expression.
Transgenic Numbers:
| # pups born | # founders | # expressors |
| 30 | 3 | 3 |
Description: The genetically encoded calcium indicator GCaMP8.1 is expressed under control of the FoxJ1 (forkhead box protein J1) promoter. FoxJ1 is a transcription factor involved in ciliogenesis and is required for motile ceiliated cell differentiation. It is expressed in ciliated epithelial cells in the airways of the lung, in the testis and oviduct of the reproductive tract. Expression is observed in the lung, trachea, testis and oviduct (not shown) and may also be observed in other tissues not examined. GCaMP8.1 responds to calcium levels in the cell. When calcium increases, a conformation change occurs resulting in an increase in fluorescence. When calcium decreases, fluorescence decreases. This mouse is useful for examining calcium signaling in endothelial cells.
Phenotypic Data:

anti-gfp IHC showing expression of GCaMP8.1 in bronchioles of the lung, trachea and testis
Genotyping Protocol:
| Primer GCaMP8.1 for | AAGGGAGAGGAGCTGTTCA |
| Primer GCaMP8.1 rev | CGATCTGCTCCTCTGTCAGCTGGT |
| Expected size of product: | 456bp |
Cycling conditions:
|
PCR results:
|
Terms of Use: Please contact chromus@cornell.edu for information on MTA and fees.
So as to appropriately acknowledge and credit the scientists who have produced the FoxJ1-GCaMp8.1 mouse strain, it is expected that you will include these individuals in any publication that is submitted prior to the initial publication of this line from the Kotlikoff laboratory.
Acknowledgement: Please inform us of any publications resulting from the use of this mouse and use the following statement to acknowledge their development:
The mouse strain FoxJ1-GCaMP8.1 was developed by CHROMusTM which is supported by the National Heart Lung Blood Institute of the National Institute of Health under award number R24HL120847.

